Details for Substrate
c-fos sis inducible element (hSIE) without Explicit Binding Affinity Data |
Binding Enzyme 1: | Signal transducer and activator of transcription 3 |
Binding Enzyme 2: | Signal transducer and activator of transcription 1-alpha/beta |
Binding Enzyme 3: | Signal transducer and activator of transcription 1-alpha/beta/3 |
Synonyms: |
32P-labeled c-fos sis inducible element (hSIE)
|
Type: | Oligonucleotide |
Topology: | Linear |
Mol. Mass.: | 2192.56 Dalton |
Organism: | n/a |
Description: | hSIE derived from the c-fos gene promoter. |
Residue: | 24 |
Sequence: | AGCTTCATTTCCCGTAAATCCCTA |
|