Details for Substrate c-fos sis inducible element (hSIE) without Explicit Binding Affinity Data
Binding Enzyme 1: Signal transducer and activator of transcription 3
Binding Enzyme 2: Signal transducer and activator of transcription 1-alpha/beta
Binding Enzyme 3: Signal transducer and activator of transcription 1-alpha/beta/3
Synonyms:  32P-labeled c-fos sis inducible element (hSIE)
Type: Oligonucleotide
Topology: Linear
Mol. Mass.: 2192.56 Dalton
Organism: n/a
Description: hSIE derived from the c-fos gene promoter.
Residue: 24
Sequence: AGCTTCATTTCCCGTAAATCCCTA